Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0036877 | |||
Gene | FURIN | Organism | Human |
Genome Locus | chr15:91421361-91426687:+ | Build | hg19 |
Disease | Pre- Eclampsia (PE) | ICD-10 | Pre-eclampsia (O14) |
DBLink | Link to database | PMID | 29643944 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | 34 patients with PE and 110 matched normal healthy women |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TTTGTAAGATGCTGGGTTGGTG ReverseACTGCATCTGTCACCTCGC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Hu, X, Ao, J, Li, X, Zhang, H, Wu, J, Cheng, W (2018). Competing endogenous RNA expression profiling in pre-eclampsia identifies hsa_circ_0036877 as a potential novel blood biomarker for early pre-eclampsia. Clin Epigenetics, 10:48. |